Part 1: Transcribe a small fragment of DNA (3 pts) Start with a DNA sequence for the coding strand of a hypothetical gene and provide the sequence of the corresponding template strand, and resulting mRNA sequence after transcription:Coding Strand of DNA: 5' GCTATGGGCTTCAGAGATTCGTGA 3'On a blank piece of paper, copy the coding strand of DNA onto a piece of paper, and use different colors for each nucleotide. You can either use different colors of ink or shade with colored pencils, crayons, or hig

Differentiate between the following: Template strand and Coding strand - Biology | Shaalaa.com

Unterschied zwischen Template und Coding-Strang | Template vs Coding Strand - Wissenschaft & Natur 2025